Extraction located on chromosome 2. This gene encrypts

Extraction of DNA

                  Using
a cotton swab, epithelial cheek cells were obtained from a group of students to
be transferred into a solution that extracts the DNA. To hurry the procedure,
the samples were heated at 65°C before centrifugation at a very high speed.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Upon exchange to 98°C, the specimens were incubated. This process ruptured the
cell and discharged its contents into the tube. The tube was centrifuged to isolate
the genetic content from other cell contents and then put into an ice bath to conserve
its material (Leicht and McAllister 2017). 

 

PCR Amplification of the Loci

The
first locus analyzed was TAS2R38. Located on Chromosome 7, this gene encrypts
the capacity to taste the sour chemical, PTC. A TAS2R38F primer was utilized to
identify the DNA sequence 5’AACTGGCAGATTAAAGATCTCAATTTAT3′, and its
corresponding primer, TAS2R38R, that identified the sequence
5’AACACAAACCATCACCCCTATTTT3′; 20µl of the TAS2R3F primer was added to 5µl of the
cheek cell DNA in a 0.2mL PCR tube labeled T, containing 25µl of Taq DNA
Polymerase, deoxyribonucleotide triphosphates, Mg, and a buffer, also known as
the “Master Mix” (Leicht and McAllister 2017).

The
second locus analyzed was the LCT gene, located on chromosome 2. This gene encrypts
the capacity to make lactase in order to break down lactose. The primer LCT-For
identified the target sequence 5’GTTGAATGCTCATACGACCATG3′. Its corresponding
primer, LCT-Rev identifies the reversed sequence,
5’TGCTTTGGTTGAAGCGAAGCGAAGATG3′. For this procedure, the exact amounts of cheek
cell DNA, and Master Mix were utilized for this PCR as the TAS2R38 PCR to get
an accurate outcome (Leicht and McAllister 2017).

                  Once
the PCR samples have been set up accordingly, they were each centrifuged for
roughly five seconds, and then put into a thermocycler for 5 minutes at 95°C;
this guarantees the separation of the DNA strands. Afterwards, 40 cycles of 30 seconds
at 95°C to denature the DNA, 30 seconds at 55°C for annealing the DNA and
primers, and 30 seconds at 72°C for synthesizing the new DNA. Finally, complete
the synthesis started by cycling for 5 minutes at 72°. The new synthesized DNA was
then solidified for two weeks until the next wet lab. (Leicht and McAllister
2017).

 

Electrophoresis of DNA

                  Within
two weeks, the amplified DNA was ready and prepared to run in the agarose gel
solution. In a 0.5 ml tube marked L, a series of substances were added, (5µl of
“L” PCR DNA, with 5µl of sterile H2O, and 10µl of a restriction enzyme
cocktail, “B”), centrifuged for five seconds to get the contents to the bottom,
and then placed in a heated water bath at 65°C for an hour. In the other 0.5 ml
tube marked T, the procedure was similar, but differed in the DNA and
restriction enzyme cocktail. “T” PCR DNA and the restriction enzyme cocktail, “F”
were utilized, and placed in a 37°C water bath. One 30-ml 1.6% agarose gels prepared
and stained with ethidium bromide for electrophoresis (Leicht and McAllister
2017). (Due to a low number of subjects, the group was forced to do one gel
rather than two.) 3µl of bromophenol blue gel dye was then added, and the gel
was filled with a DNA size marker in well 1, two uncut groupings served as
controls in wells 2 and 5, and the cut DNA in wells 3-4 and 6-7. The eighth
well was left void. The electrophoresis ran for 30-40 minutes; then a
photograph of the gel was taken to examine.

 

Using the Hardy-Weinberg Equations

Once
the procedure was completed and photographs were taken of the gel, the
Hardy-Weinberg Equation was used to calculate the allelic frequencies:

 

Freq(CB)
= 2(#CBCB) + (#CBCG)/total
alleles

 

As
indicated by the Hardy-Weinberg Principle, if the population is in equilibrium,
then the allelic and genotypic frequencies in a population stay consistent over
a generation. Thus, the frequencies of the dominant and recessive alleles will
equal 1:

 

p(dominant
allele) + q(recessive allele) = 1

 

Applied
to the genotypic frequency:

 

p2 + 2pq + q2 = 1

 

The Chi-square goodness of fit
test was then used to determine if the data given corresponded to the standards
of the Hardy-Weinberg Principle, and if the group was at HW equilibrium. (Leicht
and McAllister 2017)

=
?(o-e)2/e